View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9164J-LTR4-TNT-insertion-12 (Length: 215)
Name: F9164J-LTR4-TNT-insertion-12
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9164J-LTR4-TNT-insertion-12 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 8 - 205
Target Start/End: Original strand, 21093753 - 21093950
Alignment:
Q |
8 |
gtattagcataataactatatcatgctccctaatgtattgttctttaaaagcttagagttttctcaatgttgatatatagaaaagaataacaattattga |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21093753 |
gtattagcataataactatatcatgctccctaatgtattgttctttaaaagcttagagttttctcaatgttgatatatagaaaagaataacaattattga |
21093852 |
T |
|
Q |
108 |
agaaatggattaaatattatagggccataggcatagcagaaaataataaatttatttgnnnnnnnntaatatatttattgtgcaagtttatttaatta |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
21093853 |
agaaatggattaaatattatagggccataggcatagcagaaaataataaatttatttgaaaaaaaataatatatttattgtgcaagtttatttaatta |
21093950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 42071 times since January 2019
Visitors: 7183