View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9164J-LTR4-TNT-insertion-16 (Length: 153)
Name: F9164J-LTR4-TNT-insertion-16
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9164J-LTR4-TNT-insertion-16 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 144
Target Start/End: Complemental strand, 23267631 - 23267495
Alignment:
Q |
8 |
ctaagcacaagccaattatatataacccaaagactcttacgaatctcgtgattttaaatttcaactttcaaatatannnnnnncttcaaaaaacatgtta |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
23267631 |
ctaagcacaagccaattatatataacccaaagactcttacgaatctcgtgattttaaatttcaactttcaaatatatttttttcttcaaaaaacatgtta |
23267532 |
T |
|
Q |
108 |
aatgtattttcttatggaattaaatgcactgcaattg |
144 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
23267531 |
aatgtattttcttatggaattaaatgcactgcaattg |
23267495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7341 times since January 2019
Visitors: 7957