View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9164J-LTR4-TNT-insertion-6 (Length: 244)
Name: F9164J-LTR4-TNT-insertion-6
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9164J-LTR4-TNT-insertion-6 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 186
Target Start/End: Original strand, 9976158 - 9976336
Alignment:
Q |
8 |
attcattgcattaagttcaatgaacaagtttagcagcaagccatcaataactgtgttgaaagcctcttagaacaagagctaaagtaaaaggcatattgaa |
107 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9976158 |
attcattgcattaaattcaatgaacaagtttagcagcaagccatcaataactgtgttgaaagcctcttagaacaagagctaaagtaaaaggcatattgaa |
9976257 |
T |
|
Q |
108 |
tctatcaatatgaaccttcatggttgagcgaaggatgagtttatgtgggaaattcacatacctaaagttagaattcttg |
186 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9976258 |
tctatcaatatgaaccttcatggttgagcgaaggatgagtttatgtgggaaattcacatacctaaagttagaattcttg |
9976336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 7112510 - 7112472
Alignment:
Q |
8 |
attcattgcattaagttcaatgaacaagtttagcagcaa |
46 |
Q |
|
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
T |
7112510 |
attcattgcattaaattcaatgaacaggtttagcagcaa |
7112472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1916 times since January 2019
Visitors: 2201