View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9186J-LTR4-TNT-insertion-2 (Length: 227)
Name: F9186J-LTR4-TNT-insertion-2
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9186J-LTR4-TNT-insertion-2 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 20830873 - 20831080
Alignment:
Q |
10 |
gatttccaacacatccattgttcaaattctcagtagaagacactctcaaatttagtgtccgacaatttcacaaatatcctttctacaatacattttacac |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20830873 |
gatttccaacacatccattgttcaaattctcagtagaagacactctcaaatttagtgtccgacaatttcacaaatatcctttctacaatacattttacac |
20830972 |
T |
|
Q |
110 |
attacaaatgaccctgtggaggggcaggtagggctaattgatatggcaagcaaaaccatattagatcttgatatacagccatgtttttgatagaaaatga |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
20830973 |
attacaaatgaccctgtggaggggcaggtagggctaattgatatggcaagcaaaaccatattagatcttgatatacagccatgtttttgatagaaaatga |
20831072 |
T |
|
Q |
210 |
attcatta |
217 |
Q |
|
|
||| |||| |
|
|
T |
20831073 |
attgatta |
20831080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3724 times since January 2019
Visitors: 6276