View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9186J-LTR4-TNT-insertion-9 (Length: 140)
Name: F9186J-LTR4-TNT-insertion-9
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9186J-LTR4-TNT-insertion-9 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 43456183 - 43456305
Alignment:
Q |
8 |
cgtaccatagttaactgactgttttacatatacgtcaagatatggaataattccaattacagcatggttggatcactgcaaactggatcagaagtgcggg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43456183 |
cgtaccatagttaactgactgttttacatatacgtcaagatatggaataattccaattacagcatggttggatcactgcaaactggatcagaagtgcggg |
43456282 |
T |
|
Q |
108 |
ctatggcagtgagttcagaatta |
130 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
43456283 |
ctatggcagtgagttcagaatta |
43456305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21705 times since January 2019
Visitors: 3108