View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9276-LTR4-TNT-insertion-6 (Length: 214)
Name: F9276-LTR4-TNT-insertion-6
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9276-LTR4-TNT-insertion-6 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 206
Target Start/End: Original strand, 36051342 - 36051539
Alignment:
Q |
9 |
aagaagtatattctgatagtgcattgaattttttatttatcttgaattggtagaccaaaattgcacatgcttaaggagatcagatgttgttttagtctcg |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36051342 |
aagaagtatattctgatagtgcattgaattttttatttatcttgaattggtagaccaaaattgcacatgcttaaggagatcagatgttgttttagtctcg |
36051441 |
T |
|
Q |
109 |
attaaaaatgatgctagtcaatatgtttaatgagtgaatcacaataagaataataacatgatcataaatttatatccattactggatagagtataatt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36051442 |
attaaaaatgatgctagtcaatatgtttaatgagtgaatcacaataagaataataacatgatcataaatttatatccattactggatagagtataatt |
36051539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 40017 times since January 2019
Visitors: 7162