View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-6 (Length: 214)

Name: F9276-LTR4-TNT-insertion-6
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9276-LTR4-TNT-insertion-6
F9276-LTR4-TNT-insertion-6
[»] chr2 (1 HSPs)
chr2 (9-206)||(36051342-36051539)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 206
Target Start/End: Original strand, 36051342 - 36051539
Alignment:
9 aagaagtatattctgatagtgcattgaattttttatttatcttgaattggtagaccaaaattgcacatgcttaaggagatcagatgttgttttagtctcg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36051342 aagaagtatattctgatagtgcattgaattttttatttatcttgaattggtagaccaaaattgcacatgcttaaggagatcagatgttgttttagtctcg 36051441  T
109 attaaaaatgatgctagtcaatatgtttaatgagtgaatcacaataagaataataacatgatcataaatttatatccattactggatagagtataatt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36051442 attaaaaatgatgctagtcaatatgtttaatgagtgaatcacaataagaataataacatgatcataaatttatatccattactggatagagtataatt 36051539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 40017 times since January 2019
Visitors: 7162