View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9282-LTR4-TNT-insertion-4 (Length: 276)
Name: F9282-LTR4-TNT-insertion-4
Description: F9282-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9282-LTR4-TNT-insertion-4 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 9 - 142
Target Start/End: Complemental strand, 3026590 - 3026457
Alignment:
Q |
9 |
cactgtctgtttggtcttacttcagatttacctcagcattgtgctgacaatttcagcacctgaaactgccattgtaacacaggttcctggtttcaatgga |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3026590 |
cactgtctgtttggtcttacttcagatttacctcagcattgtgctgacaatttcagcacctgaaactgccattgtaacacaggttcctggtttcaatgga |
3026491 |
T |
|
Q |
109 |
acaataccttccaagcattatgctgggtatgtag |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
3026490 |
acaataccttccaagcattatgctgggtatgtag |
3026457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 228 - 266
Target Start/End: Complemental strand, 3026371 - 3026333
Alignment:
Q |
228 |
gacttatttgaagaaacgcattatgttatgttttgatta |
266 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3026371 |
gacttatttgaagaaacgcattatgttatgttttgatta |
3026333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9981 times since January 2019
Visitors: 7355