View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9285J-LTR4-TNT-insertion-4 (Length: 173)
Name: F9285J-LTR4-TNT-insertion-4
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9285J-LTR4-TNT-insertion-4 |
| |
|
[»] scaffold0405 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 1e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 1e-82
Query Start/End: Original strand, 9 - 163
Target Start/End: Complemental strand, 8028411 - 8028257
Alignment:
Q |
9 |
ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttctttctttatggattttcatttgcgagg |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8028411 |
ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttctttctttatggattttcatttgcgagg |
8028312 |
T |
|
Q |
109 |
atttaagcccctggtttgggttgtttgctgactattttcctggattatgtgatta |
163 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8028311 |
atttaagcccctggtttgggttgtttgctgactattttcctggattatgtgatta |
8028257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 14403 - 14328
Alignment:
Q |
9 |
ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttcttt |
84 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
14403 |
ctttgttgcaggtgggaacatttatttatgtttgtgaaaccgtgtttttgtttggtaatttgagcttagtttcttt |
14328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 86 - 163
Target Start/End: Original strand, 770558 - 770636
Alignment:
Q |
86 |
tttatggattttcatttgcgaggatttaagcccctggtttgggttgtttgctgacta-ttttcctggattatgtgatta |
163 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
770558 |
tttatggatttgcatttgcgagaatttaagcccctggtttgggttttttgctgactatttttcctggattatgtgatta |
770636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 9 - 84
Target Start/End: Original strand, 27349996 - 27350070
Alignment:
Q |
9 |
ctttgttgcaggtgtgaacatttatttatgtttgtgaaaccgtgttttagtttggtaatttgagcttagtttcttt |
84 |
Q |
|
|
|||||||||||||| ||||||| ||||||||||||||| | ||||||||||||||||||| |||||||||||||| |
|
|
T |
27349996 |
ctttgttgcaggtgggaacatt-atttatgtttgtgaatgcatgttttagtttggtaatttcagcttagtttcttt |
27350070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 86 - 163
Target Start/End: Complemental strand, 51389497 - 51389416
Alignment:
Q |
86 |
tttatggattttcatttgcgaggatttaagcccctggtttggg---ttgtttgctgacta-ttttcctggattatgtgatta |
163 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||| || ||||||||||| ||||| ||||||||||||||| |
|
|
T |
51389497 |
tttatggatttgcatttgcgagaatttaagcccctggtttgggtttttttttgctgactatttttcatggattatgtgatta |
51389416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3460 times since January 2019
Visitors: 6262