View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9285J-LTR4-TNT-insertion-6 (Length: 54)
Name: F9285J-LTR4-TNT-insertion-6
Description: F9285J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9285J-LTR4-TNT-insertion-6 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.0000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 28840909 - 28840873
Alignment:
Q |
8 |
agagtttccaacaaaagaatttaaagggaagtgatta |
44 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
28840909 |
agagtttccaacaaaagaatttaaagggaagtgatta |
28840873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14536 times since January 2019
Visitors: 7844