View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9295-LTR4-TNT-insertion-7 (Length: 227)
Name: F9295-LTR4-TNT-insertion-7
Description: F9295-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9295-LTR4-TNT-insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 218
Target Start/End: Complemental strand, 38154059 - 38153849
Alignment:
| Q |
8 |
gtttttaggtttaacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38154059 |
gtttttaggtttaacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagc |
38153960 |
T |
|
| Q |
108 |
aaagatggatccctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttctccttttatttcatcttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38153959 |
aaagatggatccctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttctccttttatttcatcttt |
38153860 |
T |
|
| Q |
208 |
ttctttgaatt |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
38153859 |
ttctttgaatt |
38153849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 38160109 - 38159940
Alignment:
| Q |
20 |
aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaagctgaggagcattttgttggagggggaaagcaaagatggatcc |
119 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || |
|
|
| T |
38160109 |
aacaaaaaaatgttgttgatgatgattatgacggctatgatttggaacatggcaaaagctgaggagcattttgttggagggggaaggcaaggatggaacc |
38160010 |
T |
|
| Q |
120 |
ctggtaataacttgacaaaatggtccttgaatgagcactttcgtgtgaatgattggttatgtaagttttc |
189 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
38160009 |
ctagtaataacttgacaaaatggtccttgaatgagcactttcatgtgaatgattggctatgtaagttttc |
38159940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 38223386 - 38223330
Alignment:
| Q |
20 |
aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaa |
76 |
Q |
| |
|
||||||| |||||||| | ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
38223386 |
aacaaaaacatgttgttgaagatgattatgatggctatgatgtggagcatggcaaaa |
38223330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 38229798 - 38229742
Alignment:
| Q |
20 |
aacaaaacaatgttgttaatgatgattatgacggctatgatgtggaacatggcaaaa |
76 |
Q |
| |
|
||||||| |||||||| | ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
38229798 |
aacaaaaacatgttgttgaagatgattatgatggctatgatgtggagcatggcaaaa |
38229742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5509 times since January 2019
Visitors: 6468