View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9301-LTR4-TNT-insertion-1 (Length: 103)
Name: F9301-LTR4-TNT-insertion-1
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9301-LTR4-TNT-insertion-1 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 22797119 - 22797034
Alignment:
Q |
8 |
gtttagggtgaaccacttttgaatgattcatccatagatcttctggtttctgatgatagccaaaaggttaagtaataagtggaatt |
93 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22797119 |
gtttagggtgaaccacttttgaatgattcatccatagatcttctggtttctgatgatagccaaaaggttaagtaataagtggaatt |
22797034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 40962008 - 40961956
Alignment:
Q |
8 |
gtttagggtgaaccacttttgaatgattcatccatagatcttctggtttctga |
60 |
Q |
|
|
|||| ||||||||||||||||||||||| | ||||| ||| || ||||||||| |
|
|
T |
40962008 |
gtttcgggtgaaccacttttgaatgatttagccataaatcatccggtttctga |
40961956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9404 times since January 2019
Visitors: 6804