View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9301-LTR4-TNT-insertion-10 (Length: 122)
Name: F9301-LTR4-TNT-insertion-10
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9301-LTR4-TNT-insertion-10 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 10 - 113
Target Start/End: Original strand, 53560474 - 53560577
Alignment:
Q |
10 |
aattaatcaaaatgtgcatgagagactagtaagtacaaaagagagtaatgttgagggggtccgaatcgctcattttaaacttggatttaaaaattgcaca |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53560474 |
aattaatcaaaatgtgcatgagagactagtaagtacaaaagagagtaatgttgagggggtccgaatcgctcattttaaacttggatttaaaaattgcaca |
53560573 |
T |
|
Q |
110 |
attg |
113 |
Q |
|
|
|||| |
|
|
T |
53560574 |
attg |
53560577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 44584 times since January 2019
Visitors: 7474