View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9301-LTR4-TNT-insertion-2 (Length: 446)
Name: F9301-LTR4-TNT-insertion-2
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9301-LTR4-TNT-insertion-2 |
| |
|
[»] scaffold0330 (1 HSPs) |
| | |
|
[»] scaffold0240 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 8 - 391
Target Start/End: Original strand, 40283282 - 40283665
Alignment:
Q |
8 |
gctgctaaattcagttttgcagaattatcatttgctgcaaccaaaaacattggtgtatatttcttgaaactgctgattctattgtatggtgaagtgcagg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40283282 |
gctgctaaattcagttttgcagaattatcatttgctgcaaccaaaaacattggtgtatatttcttgaaactgctgattctattgtatggtgaagtgcagg |
40283381 |
T |
|
Q |
108 |
actgaagcattaagagggaatcgttagctccttttttggcgaagtaattaatgtgattttcttatttagttttgctatgagtgaatgatgctacaagagc |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40283382 |
actgaagcattaagagggaatcgttagctccttttttggcgaagtaattaatgtgattttcttatttagttttgctatgagtgaatgatgctacaagagc |
40283481 |
T |
|
Q |
208 |
agtggtcttgtatttaattgcctcatatacttagtcttgtcctggtttgctatgccttgatgagttgttggggactttgaggtattgtatgaatgatgat |
307 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40283482 |
agtggtcttgtatttaattgcctcatatacttagtcttgtcctggtttgctatgccttgatgagttgttggggactttgaggtattgtatgaatgatgat |
40283581 |
T |
|
Q |
308 |
ggaaattttgttggctagagcataatttgtgcagcaaccacaaaaatcaattcaagacaataagtggagtttctgtcacaattg |
391 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40283582 |
ggaaattttgttggctagagcataatttgtgcagcaaccacaaaaatcaattcaagacaataagtggagtttctgtcacaattg |
40283665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 400 - 436
Target Start/End: Original strand, 18117 - 18153
Alignment:
Q |
400 |
tactttattgaagaaaattatatatccaccgtgaatt |
436 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
18117 |
tactttattgaagaaaattatatatccaccgtgaatt |
18153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0240 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0240
Description:
Target: scaffold0240; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 400 - 436
Target Start/End: Original strand, 2135 - 2171
Alignment:
Q |
400 |
tactttattgaagaaaattatatatccaccgtgaatt |
436 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
2135 |
tactttattgaagaaaattatatatccaccgtgaatt |
2171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 254 times since January 2019
Visitors: 8421