View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9301-LTR4-TNT-insertion-7 (Length: 92)
Name: F9301-LTR4-TNT-insertion-7
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9301-LTR4-TNT-insertion-7 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 4e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 4e-29
Query Start/End: Original strand, 6 - 82
Target Start/End: Complemental strand, 22796954 - 22796878
Alignment:
Q |
6 |
caacattttctgcagttttctttacctgagtatggatatcaaataaacttgtctaaacttggaatgcattaagatta |
82 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
22796954 |
caacattttctgcagttttctttacctgaatatggatatcaaataaacttgtcacaacttggaatgcattaagatta |
22796878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13955 times since January 2019
Visitors: 7619