View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9302-LTR4-TNT-insertion-4 (Length: 69)
Name: F9302-LTR4-TNT-insertion-4
Description: F9302-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9302-LTR4-TNT-insertion-4 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 33718799 - 33718851
Alignment:
Q |
7 |
aatttcatctcccggattccaccatcggaagcagcagcagcatggagcgaatt |
59 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33718799 |
aatttcatctcccggattccaccatcggaagcagcagcagcatggagcgaatt |
33718851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 36970 times since January 2019
Visitors: 7129