View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9303-LTR4-TNT-insertion-3 (Length: 198)
Name: F9303-LTR4-TNT-insertion-3
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9303-LTR4-TNT-insertion-3 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 8 - 188
Target Start/End: Complemental strand, 35201690 - 35201510
Alignment:
Q |
8 |
gcacttacgagctatataaaaaatacaaatcacttccttacgaacatgctttataaacctctcattgatctcaattataaattcaaatattagatatgtg |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
35201690 |
gcacttacgagctatataaaaaatacaaatcacttccttacgaacatgctttataaacctctcattgatctcaattatagattcaaatattagatatgtg |
35201591 |
T |
|
Q |
108 |
aatatatctcaattacgttcaattatagaaatttaaaaaggaatgaagggtgtagatgtctcacatgtataaagctcatta |
188 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35201590 |
aatatatctcaattacgttcaattatagaaatttaaaaaggaatgaagggtgtagatgtctcacatgtataaagctcatta |
35201510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 796 times since January 2019
Visitors: 5583