View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9305-LTR4-TNT-insertion-4 (Length: 212)
Name: F9305-LTR4-TNT-insertion-4
Description: F9305-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9305-LTR4-TNT-insertion-4 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 203
Target Start/End: Complemental strand, 2473963 - 2473768
Alignment:
Q |
8 |
ggaagttgttcctagtgttggatcaaggttgcaaagagttccacactagagagagaatattaacgtgtcaagtgtgagttagaagccccacattggatat |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2473963 |
ggaagttgttcctagtgttggatcaaggttgcaaagagttccacactagagagagaatattaacgtgtcaagtgtgagttagaagccccacattggatat |
2473864 |
T |
|
Q |
108 |
aaaaaagtagatgttgcaacaaataataagtnnnnnnnctcataaacctaatgtcttgtatatttttgtatgaagagatttgccgaaactcaattg |
203 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2473863 |
aaaaaagtagatgttgcaacaaataataagtaaaaaaactcataaacctaatgtcttgtatatttttgtatgaagagatttgccgaaactcaattg |
2473768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 105
Target Start/End: Complemental strand, 31866221 - 31866176
Alignment:
Q |
60 |
gagaatattaacgtgtcaagtgtgagttagaagccccacattggat |
105 |
Q |
|
|
||||||||| | ||||||||||||||||||||| | |||||||||| |
|
|
T |
31866221 |
gagaatattgatgtgtcaagtgtgagttagaagtctcacattggat |
31866176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 105
Target Start/End: Complemental strand, 4539086 - 4539053
Alignment:
Q |
72 |
gtgtcaagtgtgagttagaagccccacattggat |
105 |
Q |
|
|
||||||||||||||||||||| |||||||||||| |
|
|
T |
4539086 |
gtgtcaagtgtgagttagaagtcccacattggat |
4539053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9071 times since January 2019
Visitors: 8293