View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9307-LTR4-TNT-insertion-6 (Length: 137)
Name: F9307-LTR4-TNT-insertion-6
Description: F9307-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9307-LTR4-TNT-insertion-6 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 34 - 129
Target Start/End: Complemental strand, 44681918 - 44681823
Alignment:
Q |
34 |
ccaatatacgattaaaccctaaatgcatgtttgtgttaacggcggtcaagtttaaaagtattacgatatacttcgtcttgtacagagacttgatta |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44681918 |
ccaatatacgattaaaccctaaatgcatgtttgtgttaacggcggtcaagtttaaaagtattacgatatacttcgtcttgtacagagacttgatta |
44681823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 32262 times since January 2019
Visitors: 7005