View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9309-LTR4-TNT-insertion-5 (Length: 155)
Name: F9309-LTR4-TNT-insertion-5
Description: F9309-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9309-LTR4-TNT-insertion-5 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 10 - 146
Target Start/End: Complemental strand, 29206872 - 29206736
Alignment:
Q |
10 |
taataattaatcaagatatatgatactaatagtgagagtgagagcaatattttactaattaattcaatatggaacagatgattgaagaggaagagatacg |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29206872 |
taataattaatcaagatatatgatactaatagtgagagtgagagcaatattttactaattaattcaatatggaacagatgattgaagaggaagagatacg |
29206773 |
T |
|
Q |
110 |
tttgcttaggaaagaaatggttccacgagctcaattg |
146 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
29206772 |
tttgcttaggaaagaaatggttccacgagctcaattg |
29206736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 64 - 145
Target Start/End: Original strand, 38379376 - 38379457
Alignment:
Q |
64 |
ctaattaattcaatatggaacagatgattgaagaggaagagatacgtttgcttaggaaagaaatggttccacgagctcaatt |
145 |
Q |
|
|
||||||||| ||| ||||| |||||||||||||||||||||||||| |||| ||||| || ||||||||| |||||||||| |
|
|
T |
38379376 |
ctaattaatgaaatgtggaatagatgattgaagaggaagagatacgtgtgctaaggaaggatatggttccaagagctcaatt |
38379457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 41697 times since January 2019
Visitors: 7178