View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9310-LTR4-TNT-insertion-1 (Length: 84)
Name: F9310-LTR4-TNT-insertion-1
Description: F9310-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9310-LTR4-TNT-insertion-1 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 5e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 41170496 - 41170563
Alignment:
Q |
8 |
ggaagctcctggaataaagtcaccgattaatgtatttggactttactcttaaacatggagcacaattg |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41170496 |
ggaagctcctggaataaagtcaccgattaatgtatttggactttactcttaaacatggagcacaattg |
41170563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 71
Target Start/End: Original strand, 41168595 - 41168630
Alignment:
Q |
36 |
aatgtatttggactttactcttaaacatggagcaca |
71 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||| |
|
|
T |
41168595 |
aatgtatttggactttactcttaaacctggagcaca |
41168630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 45312 times since January 2019
Visitors: 6273