View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9311-LTR4-TNT-insertion-11 (Length: 318)
Name: F9311-LTR4-TNT-insertion-11
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9311-LTR4-TNT-insertion-11 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 9 - 182
Target Start/End: Complemental strand, 39762543 - 39762370
Alignment:
Q |
9 |
acgtgtcatatcatatgtttgaannnnnnnnnnnaaaattaagaaacttattttatgaaatcatcnnnnnnnnnnttattttttacgggtaatttatgaa |
108 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
39762543 |
acgtgtcatatcatatgtttgaatttttttttttaaaattaagaaacttattttatgaaatcatcaaaaaaaaaattattttttacgggtaatttatgaa |
39762444 |
T |
|
Q |
109 |
atcattaaaaattactttaannnnnnnaagggaaaaattacttttatctaaatactaattacttttcatactat |
182 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39762443 |
atcattaaaaattactttaatttttttaagggaaaaattacttttatctaaatactaattacttttcatactat |
39762370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 39762284 - 39762244
Alignment:
Q |
268 |
atttttcactccaaaatttattttttaagtttaatacatta |
308 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39762284 |
atttttcactccaaaatttattttttaagtttaatacatta |
39762244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 49599 times since January 2019
Visitors: 7205