View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9313-LTR4-TNT-insertion-9 (Length: 229)
Name: F9313-LTR4-TNT-insertion-9
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9313-LTR4-TNT-insertion-9 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 52244152 - 52244361
Alignment:
Q |
11 |
tgggagggctaaataatacagaatagatctgcaaaactttgtatcattcagtcactaacaaatttacaagaaatgaacaacaaaatcatagaaataggct |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52244152 |
tgggagggctaaataatacagaatagatctgcaaaactttgtatcattcagtcactaacaaatttacaagaaatgaacaacaaaatcatagaaataggct |
52244251 |
T |
|
Q |
111 |
gcagagcttaagcaataaccagaatgtattgataccgaatatattcagatatcataatcaggaataattgcataaaggcgaaagattaaaaaccctagct |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52244252 |
gcagagcttaagcaataaccagaatgtattgataccgaatatattcagatatcataatcaggaataattgcataaaggcgaaagattaaaaaccctagct |
52244351 |
T |
|
Q |
211 |
gagtcaattg |
220 |
Q |
|
|
|||||||||| |
|
|
T |
52244352 |
gagtcaattg |
52244361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 20457 times since January 2019
Visitors: 2882