View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9314-LTR4-TNT-insertion-6 (Length: 118)
Name: F9314-LTR4-TNT-insertion-6
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9314-LTR4-TNT-insertion-6 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 6 - 108
Target Start/End: Original strand, 44547118 - 44547220
Alignment:
Q |
6 |
caacaacttccaagtgaatattatatagctgatcacgcagttggtcttggaagcttgacagcgaataatagtaatgcaatgcttcagcaggaagaagata |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44547118 |
caacaacttccaagtgaatattatatagctgatcacgcagttggtcttggaagcttgacagcgaataatagtaatgcaatgcttcagcaggaagaagata |
44547217 |
T |
|
Q |
106 |
tta |
108 |
Q |
|
|
||| |
|
|
T |
44547218 |
tta |
44547220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 389 times since January 2019
Visitors: 8645