View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9315-LTR4-TNT-insertion-11 (Length: 212)

Name: F9315-LTR4-TNT-insertion-11
Description: F9315-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9315-LTR4-TNT-insertion-11
F9315-LTR4-TNT-insertion-11
[»] chr3 (1 HSPs)
chr3 (10-202)||(52495495-52495687)
[»] chr1 (1 HSPs)
chr1 (152-199)||(7217515-7217562)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 202
Target Start/End: Complemental strand, 52495687 - 52495495
Alignment:
10 atcaacgctggctgtagtagaattgaattgtggggattcagtgctagtaacaaaatcaagcctaattccctttcttgccatgtaaatatgagaaagtgca 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52495687 atcaacgctggctgtagtagaattgaattgtggggattcagtgctagtaacaaaatcaagcctaattccctttcttgccatgtaaatatgagaaagtgca 52495588  T
110 gaactgtgatgaattgcagtttcaactcatcttcaaatggtagtggaagtatggctgaaaattttaatgaaaatgatgaagattatgttaatt 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52495587 gaactgtgatgaattgcagtttcaactcatcttcaaatggtagtggaagtatggctgaaaattttaatgaaaatgatgaagattatgttaatt 52495495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 199
Target Start/End: Complemental strand, 7217562 - 7217515
Alignment:
152 gtggaagtatggctgaaaattttaatgaaaatgatgaagattatgtta 199  Q
    ||||||||||||| |||| ||| |||||||| ||||||||||||||||    
7217562 gtggaagtatggcagaaagtttcaatgaaaaagatgaagattatgtta 7217515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 418 times since January 2019
Visitors: 6564