View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9315-LTR4-TNT-insertion-6 (Length: 157)
Name: F9315-LTR4-TNT-insertion-6
Description: F9315-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9315-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 149
Target Start/End: Original strand, 26800697 - 26800838
Alignment:
| Q |
8 |
aatgtttgaagtaaccaattagaaagaagaaagtaaagggagcacatgggagaagatatatatacttatcttatctagttttaacattttgaaaaagtat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26800697 |
aatgtttgaagtaaccaattagaaagaagaaagtaaagggagcacatgggagaagatatatatacttatcttatctagttttaacattttgaaaaagtat |
26800796 |
T |
|
| Q |
108 |
ataatatatgtaatcaaatagtacatgagcacatgacaattg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26800797 |
ataatatatgtaatcaaatagtacatgagcacatgacaattg |
26800838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 505 times since January 2019
Visitors: 2812