View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9320-LTR4-TNT-insertion-2 (Length: 154)
Name: F9320-LTR4-TNT-insertion-2
Description: F9320-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9320-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 26 - 145
Target Start/End: Complemental strand, 44034950 - 44034831
Alignment:
| Q |
26 |
gatcaagtttgatcaaaagattaggataatacaaaatctcttatctttgaccaaaattggagtgatgagttataaactcttctaccnnnnnnntatagct |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44034950 |
gatcaagtttgatcaaaagattaggataatacaaaatctcttatctttgaccaaaattggagtgatgagttataaactcttctaccaaaaaaatatagct |
44034851 |
T |
|
| Q |
126 |
ttagcctttaaaagcaattg |
145 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44034850 |
ttagcctttaaaagcaattg |
44034831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21743 times since January 2019
Visitors: 6578