View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9320-LTR4-TNT-insertion-4 (Length: 451)
Name: F9320-LTR4-TNT-insertion-4
Description: F9320-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9320-LTR4-TNT-insertion-4 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 434; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 434; E-Value: 0
Query Start/End: Original strand, 8 - 441
Target Start/End: Original strand, 34435673 - 34436106
Alignment:
Q |
8 |
ttttttagatctaaaatacttagcttgtaatctagactgtctgatcttgattggacaacctatttacaatccggatctgacatatgtggttgcctttaat |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34435673 |
ttttttagatctaaaatacttagcttgtaatctagactgtctgatcttgattggacaacctatttacaatccggatctgacatatgtggttgcctttaat |
34435772 |
T |
|
Q |
108 |
tacgtctattttttcaaaattattattagtagttatgtgtcagcttgtgtctggtgcgtgtgtctgtgttcatgcttcatagataacatcacacatcaat |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34435773 |
tacgtctattttttcaaaattattattagtagttatgtgtcagcttgtgtctggtgcgtgtgtctgtgttcatgcttcatagataacatcacacatcaat |
34435872 |
T |
|
Q |
208 |
agtttaatgcatatgaacaaatgttttaaatcagtcgcactgcaattgcgaaatattgtggtcgaatagaattgatgtaactgtaattgcgattttcata |
307 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34435873 |
agtttaatgcatatgaacaaatgttttaaatcagtcgcactgcaattgcgaaatattgtggtcgaatagaattgatgtaactgtaattgcgattttcata |
34435972 |
T |
|
Q |
308 |
cggttgttgagagataaaaaatcttgacgttgcaactataaccgcggttacaaaaccgttttacagaaccttgatttgaagctatgattttttcttggtt |
407 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34435973 |
cggttgttgagagataaaaaatcttgacgttgcaactataaccgcggttacaaaaccgttttacagaaccttgatttgaagctatgattttttcttggtt |
34436072 |
T |
|
Q |
408 |
gaacataagctctagttagttgtgccaacaatta |
441 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
34436073 |
gaacataagctctagttagttgtgccaacaatta |
34436106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25790 times since January 2019
Visitors: 7113