View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9322-LTR4-TNT-insertion-2 (Length: 373)
Name: F9322-LTR4-TNT-insertion-2
Description: F9322-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9322-LTR4-TNT-insertion-2 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 172 - 365
Target Start/End: Original strand, 2037866 - 2038059
Alignment:
Q |
172 |
cctgaaaatttgatgtatgagtacgcttatgtgattttgcagaaatgttggtcacatctttgagtccaacaacaacagcttgttcatttcttgaaggctc |
271 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2037866 |
cctgaaaatttgatgtatgagtacgcttatgtgattttgcagaaatgttggtcacatctttgagtccaacaacaacagcttgttcatttcttgaaggctc |
2037965 |
T |
|
Q |
272 |
cttcaaagctcttgcccttgctcgagtcaccctcacattcacaccattttctttgtccattttgctctccctcactgtatcagtcacaatatta |
365 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2037966 |
cttcaaagctcttgcccttgctcgagtcaccctcacattcacaccattttctttgtccattttgctctccctcactgtatcagtcacaatatta |
2038059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 2037701 - 2037753
Alignment:
Q |
7 |
acaaacaaacatgtactcatgtcctacaaattatttcaattcatactcaattt |
59 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2037701 |
acaaacaaacatgtactcatgtcctacaaattatttcaattcatactcaattt |
2037753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4486 times since January 2019
Visitors: 6240