View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-21-02 (Length: 328)
Name: J5-21-02
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-21-02 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 163 - 328
Target Start/End: Original strand, 421292 - 421457
Alignment:
| Q |
163 |
ctaattgccactcctaattttaaacttataaaaactttttgctttgaactcttaatctcacacacttattgagttttatagtggaaatgacattttaata |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421292 |
ctaattgccactcctaattttaaacttataaaaactttttgctttgaactcttaatctcacacacttattgagttttatagtggaaatgacattttaata |
421391 |
T |
|
| Q |
263 |
tctagtttttgggcattgaatgagggccataaactgttctaacttgttttttagtaataaaattct |
328 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421392 |
tctagtttttgggcattaaatgagggccataaactgttctaacttgttttttagtaataaaattct |
421457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 421157 - 421214
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421157 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
421214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 30815670 - 30815613
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30815670 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
30815613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 421453 - 421483
Alignment:
| Q |
1 |
attcttacattgtatcagccagtgttgaatt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
421453 |
attcttacattgtatcagccagtgttgaatt |
421483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 10369572 - 10369629
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10369572 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
10369629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 38481565 - 38481622
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38481565 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
38481622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 41397920 - 41397863
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41397920 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
41397863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 17255577 - 17255520
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17255577 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
17255520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 46244227 - 46244284
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46244227 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
46244284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 45198028 - 45197971
Alignment:
| Q |
28 |
aattggatggactagatccatccatattgtttaatggatggattggatacaatccatt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
45198028 |
aattggatggactagatccatccatattgtttaatggatcgattggatacagtccatt |
45197971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12470 times since January 2019
Visitors: 8218