View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-21-77 (Length: 140)
Name: J5-21-77
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-21-77 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 2e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 2e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 49952939 - 49953078
Alignment:
Q |
1 |
gttagcaccgccgcgacatgagtgcaagtgtctgggttcgaacccacaacatcttattctattccaatttatttgtatgataaaggagctatatgtaata |
100 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49952939 |
gttagcaccgctgcgacatgagtgcaagtgtctgggttcgaacccacaacatcttattctattccaatttatttgtatgataaaggagctatatgtaata |
49953038 |
T |
|
Q |
101 |
tgtagatgaaattaaaggagggagcaaagcaaagtattaa |
140 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49953039 |
tgtagatgaaattaaaggagggagcaaagcaaagtattaa |
49953078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12173 times since January 2019
Visitors: 8179