View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-5-15 (Length: 251)
Name: J5-5-15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-5-15 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 22 - 251
Target Start/End: Original strand, 34011367 - 34011596
Alignment:
| Q |
22 |
aattaatcttaagacgaagggagtataaaccatgctcatttaatttagttgtcattgagccgcactaaggtacttgcgaataaattttcctaagttaagg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34011367 |
aattaatcttaagacgaagggagtataaaccatgctcatttaatttagttgtcattgagccgcactaaggtacttgcgaataaattttcctaagttaagg |
34011466 |
T |
|
| Q |
122 |
tgttctttaccgagcctaattatttcaaactgaactcactaaacactgatttgttagagatatctaagataaggtatagcaggtcattggtttattacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34011467 |
tgttctttaccgagcctaattatttcaaactgaactcactaaacactgatttgttagagatatctaagataaggtatagcaggtcattggtttattacaa |
34011566 |
T |
|
| Q |
222 |
atttacaaccaatcatagcatgcttttaac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34011567 |
atttacaaccaatcatagcatgcttttaac |
34011596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 34011592 - 34011621
Alignment:
| Q |
1 |
ttaacaataccaaagattatgaattaatct |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34011592 |
ttaacaataccaaagattatgaattaatct |
34011621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12428 times since January 2019
Visitors: 8218