View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-5-72 (Length: 255)
Name: J5-5-72
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-5-72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 3332442 - 3332585
Alignment:
| Q |
1 |
tgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgttgctgttttcttctcggtttgtgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332442 |
tgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgtgctgaacttgttgttgctgttttcttctcggtttgtgagg |
3332541 |
T |
|
| Q |
101 |
ttgagtccaccgccgctgctacttccgctttgttcatcttgatc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332542 |
ttgagtccaccgccgctgctacttccgctttgttcatcttgatc |
3332585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9329 times since January 2019
Visitors: 7893