View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-5-82 (Length: 200)
Name: J5-5-82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-5-82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 35339685 - 35339800
Alignment:
| Q |
1 |
atagagtgggtgactatttaagttattggagtcgtgttgtgtttacttatccatannnnnnngtttaatttctttttatatgggttgggcattatagggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35339685 |
atagagtgggtgactatttaagttattggagtcgtgttgtgtttacttatccatatttttttgtttaatttctttttatatgggttgggcattatagggt |
35339784 |
T |
|
| Q |
101 |
tgcattagtgcaattg |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35339785 |
tgcattagtgcaattg |
35339800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11515 times since January 2019
Visitors: 8091