View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-55 (Length: 145)
Name: J5-55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-55 |
| |
|
[»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 1e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 58 - 145
Target Start/End: Original strand, 29998352 - 29998439
Alignment:
Q |
58 |
tcaattgtgttttaatcttttcaatgttgcttaaaagcattagctcttgcaaagagtgaaggatttataggttctgattggttgtttg |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29998352 |
tcaattgtgttttaatcttttcaatgttgcttaaaagcattagctcttgcaaagagtgaaggatttataggttctgattggttgtttg |
29998439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 29998435 - 29998499
Alignment:
Q |
1 |
gtttgatggaccaacaagttgtgaggtcgcattcatttgatcatgggcagccttgagtcaattgt |
65 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29998435 |
gtttgatggaccaacaagttgtgaggtcgcattcatttgatcatgggcagccttgagtcaattgt |
29998499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12159 times since January 2019
Visitors: 8179