View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-6-10 (Length: 281)
Name: J5-6-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-6-10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 56 - 265
Target Start/End: Complemental strand, 4891975 - 4891766
Alignment:
| Q |
56 |
gctatgatatggtcctgattatgagccacagacctcttagttccttgtccttgtggctttatagtttcaacgatgttttgtttttgcaatgacccttttc |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4891975 |
gctatgatatggtcctgattatgagccacagacctcttagttccttgtccttgtggctttatagtttcaacaatgttttgtttttgcaatgacccttttc |
4891876 |
T |
|
| Q |
156 |
tattttgaggtaattctgtttgtgacaatggaacaaccttgttcttttttgtatttaaggtacagtcaaaagacagaatctgagaagtggtagaagaagg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891875 |
tattttgaggtaattctgtttgtgacaatggaacaaccttgttcttttttgtatttaaggtacagtcaaaagacagaatctgagaagtggtagaagaagg |
4891776 |
T |
|
| Q |
256 |
ggaagaagtg |
265 |
Q |
| |
|
|||||||||| |
|
|
| T |
4891775 |
ggaagaagtg |
4891766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 71 - 141
Target Start/End: Complemental strand, 4916735 - 4916665
Alignment:
| Q |
71 |
tgattatgagccacagacctcttagttccttgtccttgtggctttatagtttcaacgatgttttgtttttg |
141 |
Q |
| |
|
|||| |||||| |||||||||||||| ||||||||||||| ||| |||||||||| |||||||| ||||| |
|
|
| T |
4916735 |
tgatcatgagcaacagacctcttagtcccttgtccttgtgtatttttagtttcaacaatgttttgattttg |
4916665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 4892030 - 4891996
Alignment:
| Q |
1 |
aagagcagctagagcaatcaagcantgactgagtt |
35 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
4892030 |
aagagcagctagagcaatcaagcactgactgagtt |
4891996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12489 times since January 2019
Visitors: 8218