View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-7-1-13 (Length: 253)
Name: J5-7-1-13
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-7-1-13 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 116 - 253
Target Start/End: Complemental strand, 1157681 - 1157544
Alignment:
| Q |
116 |
attaattgaagaaatgagagttgagagagaaatcaagtgaaaattatggacattgatagtgtcaacaagaattatatgcactattcttcttcattaaaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1157681 |
attaattgaagaaatgagagttgagagagaaatcaagtgaaaattaaggacattgatagtgtcaacaagaattatatgcactattcttcttcattaaaca |
1157582 |
T |
|
| Q |
216 |
ctcagtccatcgaatccacactgcttgtaagtcagaga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1157581 |
ctcagtccatcgaatccacactgcttgtaagtcagaga |
1157544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 1157548 - 1157428
Alignment:
| Q |
1 |
agagattgctttcttggactaatcactatagcacaatccaccgagacctgtgaagtttagttcatgatcaattgttaatctattggtaatgcaatgctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1157548 |
agagattgctttcttggactaatcactatagcacaatccaccgagacctgtgaagtttagttcatgatcaattgttaatctattggtaatgcaatgctta |
1157449 |
T |
|
| Q |
101 |
attaaaacaatactgattaat |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1157448 |
attaaaacaatactgattaat |
1157428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13049 times since January 2019
Visitors: 8270