View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-7-23 (Length: 149)
Name: J5-7-23
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-7-23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 28 - 141
Target Start/End: Complemental strand, 13635524 - 13635411
Alignment:
| Q |
28 |
gatagcagacaggattttgttgtattcnatattcttagtagttttttatttgatagatagatacgaaagttaaattattttacggaatgcacatgaaagt |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13635524 |
gatagcagacaggattttgttgtattcaatattcttagtagttttttatttgatagatagatacgaaagttaaattattttacggaatgcacatgaaagt |
13635425 |
T |
|
| Q |
128 |
gataagcacgtttg |
141 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13635424 |
gataagcacgtttg |
13635411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 28 - 137
Target Start/End: Original strand, 27531408 - 27531514
Alignment:
| Q |
28 |
gatagcagacaggattttgttgtattcnatattcttagtagttttttatttgatagatagatacgaaagttaaattattttacggaatgcacatgaaagt |
127 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||| ||||| ||||||||||||||| |||||| ||||||| | | |||| |||||||| ||||||| |
|
|
| T |
27531408 |
gataacagacaggatattgttgtattcaatattattagt---tttttatttgatagagagatacataagttaactaaaattactgaatgcacctgaaagt |
27531504 |
T |
|
| Q |
128 |
gataagcacg |
137 |
Q |
| |
|
|||||||||| |
|
|
| T |
27531505 |
gataagcacg |
27531514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9787 times since January 2019
Visitors: 7932