View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-7-60 (Length: 127)
Name: J5-7-60
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5-7-60 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 1e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 15 - 127
Target Start/End: Complemental strand, 19633320 - 19633209
Alignment:
Q |
15 |
ttaatattgttatatcaagtgcgaataatacctttccataacgatagataaaggtataatgatatttagtgatgctaggtatccttgaagaattgcgaat |
114 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19633320 |
ttaatattgttatatcatttgcgaataatacctttccataacaatagataaag-tataatgatatttagtgatgctaggtatccttgaagaattgcgaat |
19633222 |
T |
|
Q |
115 |
aatttatctaata |
127 |
Q |
|
|
||||||||||||| |
|
|
T |
19633221 |
aatttatctaata |
19633209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15823 times since January 2019
Visitors: 3757