View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5-7-92 (Length: 218)
Name: J5-7-92
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5-7-92 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 15201273 - 15201079
Alignment:
| Q |
1 |
tcttcctcttttcacctttcataacttgntttcctggnggctgaatgatatgtttcaatattcttcttgccgttgctacnattccngtcttagaatggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
15201273 |
tcttcctcttttcacctttcataacttgttttcctggtggctgaatgatatgtttcaatattcttcttgccgttgctacaattccagtcttagaatggtt |
15201174 |
T |
|
| Q |
101 |
tagatcaataagaatctcttcattaaaaatctgatcttggtccatcctnnnnnnncanaaggnctggcccaaaatgacaacntcgactccaaaac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||| |||||||||||| || |||| ||||| |
|
|
| T |
15201173 |
tagatcaataagaatctcttcattaaaaatctgatcttggtccatcctaaaaaaacaaaaggtctggcacaaaatgacaacatcaactcaaaaac |
15201079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 129
Target Start/End: Original strand, 16034857 - 16034904
Alignment:
| Q |
82 |
ttccngtcttagaatggtttagatcaataagaatctcttcattaaaaa |
129 |
Q |
| |
|
|||| ||||||||||| |||||||||||| ||||||| ||||| |||| |
|
|
| T |
16034857 |
ttccagtcttagaatgctttagatcaatatgaatctcatcattgaaaa |
16034904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 129
Target Start/End: Complemental strand, 31431319 - 31431272
Alignment:
| Q |
82 |
ttccngtcttagaatggtttagatcaataagaatctcttcattaaaaa |
129 |
Q |
| |
|
|||| ||||||||||| |||||||||||| ||||||| ||||| |||| |
|
|
| T |
31431319 |
ttccagtcttagaatgctttagatcaatatgaatctcatcattgaaaa |
31431272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12039 times since January 2019
Visitors: 8179