View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_13_65 (Length: 236)
Name: J5_13_65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_13_65 |
 | |
|
| [»] chr3 (4 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 35986403 - 35986290
Alignment:
| Q |
123 |
ttttatatatagttgtatct-aacaaactaaattatttnnnnnnntaataatttttactacgaaaaagaaacataaaatagatactagacacttctattt |
221 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35986403 |
ttttttatatagttgtatctgaacaaactaaattatttaaaaaa-taataatttttactacgaaaaagaaacataaaatatatactagacacttctattt |
35986305 |
T |
|
| Q |
222 |
tcttctagtgaagtg |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35986304 |
tcttctagtgaagtg |
35986290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 60 - 106
Target Start/End: Complemental strand, 35986181 - 35986135
Alignment:
| Q |
60 |
atttgattccgtttatttgaatcccgcaaaatatgaagaattaattt |
106 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35986181 |
atttgattccgtttatttgaatcccacaaaatatgaagaattaattt |
35986135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 35986294 - 35986253
Alignment:
| Q |
1 |
aagtgtgtcgaatttagattgctaaaaaagtggttttttctt |
42 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35986294 |
aagtgtgtcgaatttggattgctaaaaaagtggttttttctt |
35986253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 159
Target Start/End: Original strand, 10297251 - 10297291
Alignment:
| Q |
120 |
cccttttatatatagttgtat-ctaacaaactaaattattt |
159 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
10297251 |
cccttttatatatagttgtatccaaacaaactaaattattt |
10297291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10934 times since January 2019
Visitors: 8059