View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_14_02 (Length: 153)
Name: J5_14_02
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_14_02 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 21969900 - 21970030
Alignment:
| Q |
1 |
tggaggactaagttgatacaggtcttcattttcaatgatnnnnnnn-tttaggtattaactcaattttaacaagttgcaaaaactncctctttcacatga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21969900 |
tggaggactaagttgatacaggtcttcattttcaatgataaaaaaaatttaggtattaactcaattttaacaagttgcaaaaactacctctttcacatga |
21969999 |
T |
|
| Q |
100 |
gtgctatgatccattgtgagctgaagaggat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21970000 |
gtgctatgatccattgtgagctgaagaggat |
21970030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11572 times since January 2019
Visitors: 8091