View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_14_17 (Length: 97)
Name: J5_14_17
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_14_17 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
| [»] scaffold0128 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 2e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 33242910 - 33243006
Alignment:
| Q |
1 |
tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33242910 |
tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcatggattcagggg |
33243006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 33250830 - 33250926
Alignment:
| Q |
1 |
tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg |
97 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||| || | ||||||| |||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
33250830 |
tatgatactgaatgtagatgatagtagtctcggtaatcccgccatttcaggctttagacggttgatccgaaattctgacggtgcatggatttagggg |
33250926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 58; Significance: 6e-25; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 40513 - 40417
Alignment:
| Q |
1 |
tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg |
97 |
Q |
| |
|
||||||| | |||||||||||||||||||| ||||||| || ||||||||| ||| |||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
40513 |
tatgatattgaatgtggatggtagtagtcttggtaatcacggcgtttcaggctttggagggttgatccgaaattctaatggtgcttggattcagggg |
40417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 44985921 - 44986013
Alignment:
| Q |
1 |
tatgatacttaatgtggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattca |
93 |
Q |
| |
|
||||||| | |||||||| ||||||||||||||||||| ||||||||| | ||||||| |||||||||||||||| | ||||| |||||||| |
|
|
| T |
44985921 |
tatgatattgaatgtggacggtagtagtctcggtaatcctgacgtttcaagctttagagagttgatccgaaattctaatggtgcatggattca |
44986013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 15 - 97
Target Start/End: Complemental strand, 25606915 - 25606833
Alignment:
| Q |
15 |
tggatggtagtagtctcggtaatctcgacgtttcaggatttagagggttgatccgaaattctgacggtgcntggattcagggg |
97 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||| ||| |||||||||||| ||||||||| ||||| |||||||||||| |
|
|
| T |
25606915 |
tggatggtagtagtctcgataatcccagtgtttcaggctttggagggttgatccaaaattctgatggtgcatggattcagggg |
25606833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10355 times since January 2019
Visitors: 7978