View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_14_69 (Length: 328)
Name: J5_14_69
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_14_69 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 853065 - 852763
Alignment:
| Q |
1 |
gctcggttgaacaccttcacacgagacctcacaactatgtgagtgacttttaggtggtggttgacactgtctacataagagaaaatgatgattgattttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
853065 |
gctcggttgaacaccttcacacgagacctcacaactatgtgagtgacttttaggtggtggttgacactgtctacataagagaaaataatgattgattttg |
852966 |
T |
|
| Q |
101 |
atcaaaattaaannnnnnngagattaaatttaattcgacaatgtatcaaaaataaacttagaagtttgagtttgatattgctaggctggacaatgttacc |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
852965 |
atcaaaattaaatttttttgagattaaatttaattcgacaatgtatcaaaaataaacttagaagtttgagtttgatattgctaggctggacaatgttacc |
852866 |
T |
|
| Q |
201 |
tgcgacctcacaatgtgtgattgagtttcgggtagtagttgccactttgtctatagacnnnnnnnnttgtttgatttgattgcaacaacttgatagatta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
852865 |
tgcgacctcacaatgtgtgattgagtttcgggtagtagttgccactttgtctatagacaaaaaaaattgtttgatttgattgcaacaacttgatagatta |
852766 |
T |
|
| Q |
301 |
att |
303 |
Q |
| |
|
||| |
|
|
| T |
852765 |
att |
852763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 293 - 328
Target Start/End: Complemental strand, 853096 - 853061
Alignment:
| Q |
293 |
atagattaattagaaatttgagctgcatattgctcg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
853096 |
atagattaattagaaatttgagctgcatattgctcg |
853061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16302 times since January 2019
Visitors: 3768