View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_15_46 (Length: 283)
Name: J5_15_46
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] J5_15_46 |
| |
|
[»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 172 - 283
Target Start/End: Original strand, 2648444 - 2648555
Alignment:
Q |
172 |
aattgtcacagtgtaatgaatattcgtaccattaaaatnatataactgaccctactagatatcacaataacattcacaaagagatccatgtcgttttcat |
271 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2648444 |
aattgtcacagtgtaatgaatattcgtaccattaaaatcatataactgaccctactagatatcacaataacattcacaaagagatccatgtcgttttcat |
2648543 |
T |
|
Q |
272 |
gtcaattattct |
283 |
Q |
|
|
|||||||||||| |
|
|
T |
2648544 |
gtcaattattct |
2648555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 2648551 - 2648628
Alignment:
Q |
1 |
attcntngggaatccacagaatttttacagtcaattttgttnggaaaaattgtttttgctttacgtgcaatttgaatt |
78 |
Q |
|
|
|||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
2648551 |
attctttgggaatccacagaatttttacagtcaattttgtttggaaaaattgtttttgctttacgtgcaatttgaatt |
2648628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 42655537 - 42655492
Alignment:
Q |
127 |
tgattccagctcacatcatagctgaagcgatatcaactatccgcga |
172 |
Q |
|
|
||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
42655537 |
tgattcctgctcatatcatagctgaagcaatatcaactatccgcga |
42655492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 72 - 175
Target Start/End: Complemental strand, 45479825 - 45479722
Alignment:
Q |
72 |
ttgaattgaagctgaaaaatggtgtgaattgtatcaaaacagaanggacatgcaatgattccagctcacatcatagctgaagcgatatcaactatccgcg |
171 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45479825 |
ttgaattgaagctgaaaaatggtgtgaattgtatcaaaacagaaaggacatgcaatgattccagctcacatcatagctgaagcgatatcaactatccgcg |
45479726 |
T |
|
Q |
172 |
aatt |
175 |
Q |
|
|
|||| |
|
|
T |
45479725 |
aatt |
45479722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11034 times since January 2019
Visitors: 8059