View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_16_65 (Length: 150)
Name: J5_16_65
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_16_65 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 40 - 150
Target Start/End: Original strand, 32932557 - 32932667
Alignment:
| Q |
40 |
attaataacgtctggcccaacattatttaagtaagaatttgaactcgggttttcccaaacaatttgtctttaactgaaactcattaaggagttcaatcac |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32932557 |
attaataacgtctggcccaacattatttaagtaagaatttgaactcgggttttcccaaacaatttgtctttaactgaaactcattaaggagttcaatcac |
32932656 |
T |
|
| Q |
140 |
ttggttggtta |
150 |
Q |
| |
|
||||||||||| |
|
|
| T |
32932657 |
ttggttggtta |
32932667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 32932663 - 32932709
Alignment:
| Q |
1 |
ggttaaattgaaatagctattaaatagcgtaatgtatgtattaataa |
47 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32932663 |
ggttaaattgaaatagctattaaatagtgtaatgtatgtattaataa |
32932709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14079 times since January 2019
Visitors: 8375