View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_17_12 (Length: 128)
Name: J5_17_12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_17_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 1e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 45173873 - 45173943
Alignment:
| Q |
1 |
gaacatagctaactaacaattggtacagttagacttagagtgtgctctgctatcttccagtccatattaat |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45173873 |
gaacatagctaactaacaattggtacagttagacttagagtgtgctctgctatcttccagtccatattaat |
45173943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 66 - 128
Target Start/End: Original strand, 45173815 - 45173877
Alignment:
| Q |
66 |
attaatttgacatcaagagattgtgtaaatgnnnnnnntgtgagtaagaagattagaagaaca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45173815 |
attaatttgacatcaagagattgtgtaaatgaaaaaaatgtgagtaagaagattagaagaaca |
45173877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9672 times since January 2019
Visitors: 7932