View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_3_26 (Length: 162)
Name: J5_3_26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_3_26 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 55180304 - 55180465
Alignment:
| Q |
1 |
gattgaagtaagacaatgtgtttccgttatatcttgacagccacacatacaagacatcaagatcaaactcatgtccaaaaaactatcaatataatgtctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55180304 |
gattgaagtaagacaatgtgtttccgttatatcttgacagtcacacatacaagacatcaagatcaaactcatgtccaaaaaactatcaatataatgtctc |
55180403 |
T |
|
| Q |
101 |
gaatgcgtcaatgtgtgaccaaatgtcaataaatgaaattttttcaaatcttcaaaatttcg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55180404 |
gaatgcgtcaatgtgtgaccaaatgtcaataaatgaaattttttcaaatcttcaaaatttcg |
55180465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16360 times since January 2019
Visitors: 3768