View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_3_60 (Length: 238)
Name: J5_3_60
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_3_60 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 4591888 - 4592017
Alignment:
| Q |
1 |
atctctgcaaagtatttctgcctacaagatttgataggattctacatatgatttttattttgttttgaaaaaatggatcggatccttcacatgaacatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4591888 |
atctctgcaaagtatttctgcctacaagatttgataggattctacatatgatttttattttgttttgaaaaaatggatcggatccttcacatgaacatga |
4591987 |
T |
|
| Q |
101 |
taatgaaattcaagataccgtgaaagaatt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4591988 |
taatgaaattcaagataccgtgaaagaatt |
4592017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 127 - 238
Target Start/End: Original strand, 4591781 - 4591892
Alignment:
| Q |
127 |
aattgtttaggttacttcctcaaatatctcaaaatataataaacatggggtgatctgataagattcaacgcgtaaaaaagctttacaccgtcagttttca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4591781 |
aattgtttaggttacttcctcaaatatctcaaaatataataaacatggggtgatctgataagattcaacgcgtaaaaaagctttacaccgtcagttttca |
4591880 |
T |
|
| Q |
227 |
gcaattaatctc |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4591881 |
gcaattaatctc |
4591892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11362 times since January 2019
Visitors: 8091