View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_4_53 (Length: 113)
Name: J5_4_53
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_4_53 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 29103734 - 29103846
Alignment:
| Q |
1 |
ttttctccctctttttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacattatttcctcttgagaggatcttaatctcacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103734 |
ttttctccctctttttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacattatttcctcttgagaggatcttaatctcacac |
29103833 |
T |
|
| Q |
101 |
ttgagggtgagaa |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29103834 |
ttgagggtgagaa |
29103846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 75
Target Start/End: Original strand, 24538526 - 24538587
Alignment:
| Q |
14 |
tttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacattatttcc |
75 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||| |||| |||| ||| ||||||||||||| |
|
|
| T |
24538526 |
tttcaaatttcaaagatatcctccctttatatttcaatgctctaaattttcacattatttcc |
24538587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 14695921 - 14695977
Alignment:
| Q |
13 |
ttttcaaatttcaatgttatcctctctttatattttaatggtctagattgtcacatt |
69 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||| |||||| |||||| ||||||| |
|
|
| T |
14695921 |
ttttaaaattttaatgttatcctccatttatatttcaatggtgtagattttcacatt |
14695977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14167 times since January 2019
Visitors: 8375