View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: J5_4_55 (Length: 236)
Name: J5_4_55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] J5_4_55 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 23290472 - 23290708
Alignment:
| Q |
1 |
acaaattctgcgcttataaggtaccattctctgattcttccttataccgtttt-tcattctccgctcagttttgtttctatttaccattgttataatcga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23290472 |
acaaattctgcgcttataaggtaccattctctgattcttccttataccgttttttcattctccgctcagttttgtttctatttaccattgttataatcga |
23290571 |
T |
|
| Q |
100 |
tcatgcatgaagcgattctagttactatacttcttttttcatctcatcatcaccattgattcagaaacccacacctataacttcattgatattcgagttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23290572 |
tcatgcatgaagcgattctagttactatacttcttttttcatctcatcatcaccattgattcagaaacccacacctataacttcattgatattcgagttt |
23290671 |
T |
|
| Q |
200 |
tcttttgactctgaattggttgaagtgaatttagagc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23290672 |
tcttttgactctgaattggttgaagtgaatttagagc |
23290708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12610 times since January 2019
Visitors: 8222